ID: 1144263312_1144263315

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1144263312 1144263315
Species Human (GRCh38) Human (GRCh38)
Location 17:13544528-13544550 17:13544544-13544566
Sequence CCCTGCGCCGTCTGGCACAGCCC ACAGCCCCAGCCTCTTTGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108} {0: 1, 1: 0, 2: 4, 3: 27, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!