ID: 1144472606_1144472610

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1144472606 1144472610
Species Human (GRCh38) Human (GRCh38)
Location 17:15558183-15558205 17:15558207-15558229
Sequence CCTTCTGCTCTCGATCCCAACAG CTAATCGCCATCCAGCGGCCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 14, 4: 115} {0: 2, 1: 0, 2: 0, 3: 2, 4: 28}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!