ID: 1144489897_1144489908

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1144489897 1144489908
Species Human (GRCh38) Human (GRCh38)
Location 17:15699830-15699852 17:15699869-15699891
Sequence CCCCGGGTCGTTCTGTGCCGAGT GTTTGTTAAAGGGGCCTCGAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 0, 4: 10} {0: 2, 1: 0, 2: 0, 3: 0, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!