ID: 1144552802_1144552809

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1144552802 1144552809
Species Human (GRCh38) Human (GRCh38)
Location 17:16256422-16256444 17:16256464-16256486
Sequence CCACCTCCCGATTCCTCTGCCTC GCCTCAGCCTCCCGAGTAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 88, 4: 1036} {0: 94911, 1: 257638, 2: 218586, 3: 135882, 4: 139272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!