ID: 1144553261_1144553273

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1144553261 1144553273
Species Human (GRCh38) Human (GRCh38)
Location 17:16260059-16260081 17:16260090-16260112
Sequence CCCCCTGCCAACTTGGCCCTCTC GGGCAGAGATGAGCACAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 37, 3: 98, 4: 417} {0: 1, 1: 0, 2: 3, 3: 33, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!