ID: 1144574979_1144574984

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1144574979 1144574984
Species Human (GRCh38) Human (GRCh38)
Location 17:16423680-16423702 17:16423701-16423723
Sequence CCTCTGCCCTACCGTGCAGCTTG TGAGGACATCCGCAACCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 134} {0: 1, 1: 0, 2: 0, 3: 6, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!