ID: 1144581212_1144581232

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1144581212 1144581232
Species Human (GRCh38) Human (GRCh38)
Location 17:16460558-16460580 17:16460604-16460626
Sequence CCCCTCCTCCTGCCCCCATGGGC CCTGTGTCCCGCCCGGCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 74, 4: 665} {0: 1, 1: 0, 2: 1, 3: 9, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!