ID: 1144639525_1144639531

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1144639525 1144639531
Species Human (GRCh38) Human (GRCh38)
Location 17:16929963-16929985 17:16929985-16930007
Sequence CCATGGATGCTGGGTCCTGGGCT TTTGGGGCCCTGAAGGAGCAAGG
Strand - +
Off-target summary {0: 2, 1: 9, 2: 27, 3: 47, 4: 332} {0: 1, 1: 0, 2: 2, 3: 14, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!