ID: 1144658228_1144658237

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1144658228 1144658237
Species Human (GRCh38) Human (GRCh38)
Location 17:17051670-17051692 17:17051694-17051716
Sequence CCCCATGCCCTACCCAGAGCTCT AAGGCATTGTCACTTCCGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 322} {0: 1, 1: 0, 2: 1, 3: 10, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!