ID: 1144660329_1144660331

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1144660329 1144660331
Species Human (GRCh38) Human (GRCh38)
Location 17:17063909-17063931 17:17063928-17063950
Sequence CCCGCTTGGGGCAGTTGGGCAAC CAACCCAGAGTTGAGACAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 117} {0: 1, 1: 0, 2: 1, 3: 17, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!