ID: 1144675869_1144675885

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1144675869 1144675885
Species Human (GRCh38) Human (GRCh38)
Location 17:17161269-17161291 17:17161321-17161343
Sequence CCTTCTGGAGCAGAACCGGCTCC CGGGAGCAGAGCGCCCGTGAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 10, 4: 125} {0: 2, 1: 0, 2: 0, 3: 5, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!