ID: 1144685434_1144685440

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1144685434 1144685440
Species Human (GRCh38) Human (GRCh38)
Location 17:17223046-17223068 17:17223059-17223081
Sequence CCCTCAGCACCATCTGTGCTTCT CTGTGCTTCTGGAGGGCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 53, 4: 460} {0: 1, 1: 2, 2: 3, 3: 47, 4: 431}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!