ID: 1144722752_1144722753

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1144722752 1144722753
Species Human (GRCh38) Human (GRCh38)
Location 17:17483595-17483617 17:17483627-17483649
Sequence CCGCAGTTGAATGAAAAATTAAA TATGTTATTTTTAAAGAATGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 64, 4: 723} {0: 1, 1: 2, 2: 0, 3: 111, 4: 984}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!