ID: 1144765782_1144765792

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1144765782 1144765792
Species Human (GRCh38) Human (GRCh38)
Location 17:17731697-17731719 17:17731732-17731754
Sequence CCTCCCTCCTCCTGGAGCTGCTG ATGCTGGTCTAGAGGGAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 107, 4: 792} {0: 1, 1: 0, 2: 0, 3: 18, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!