ID: 1144791545_1144791554

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1144791545 1144791554
Species Human (GRCh38) Human (GRCh38)
Location 17:17862377-17862399 17:17862398-17862420
Sequence CCTCCTGCTTCCAAGCTTCTCCT CTGTGGATGAGGGGCCAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 502} {0: 1, 1: 0, 2: 5, 3: 53, 4: 449}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!