ID: 1144824606_1144824608

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1144824606 1144824608
Species Human (GRCh38) Human (GRCh38)
Location 17:18098739-18098761 17:18098773-18098795
Sequence CCATGGTGAAACAATTTATTTGT ATCATCAGTGATGAGTGTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 279} {0: 1, 1: 0, 2: 1, 3: 10, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!