ID: 1144958087_1144958097

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1144958087 1144958097
Species Human (GRCh38) Human (GRCh38)
Location 17:19029688-19029710 17:19029732-19029754
Sequence CCAGACTGGGGCTACCCTCTGGG ACTCCCCTTCCCAAGGCCTGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 22, 4: 178} {0: 2, 1: 0, 2: 6, 3: 51, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!