ID: 1144991798_1144991814

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1144991798 1144991814
Species Human (GRCh38) Human (GRCh38)
Location 17:19238086-19238108 17:19238125-19238147
Sequence CCTTCCGTCCTTGGGGACCAGGC CCCACTCCCACGGAACAGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 158} {0: 1, 1: 0, 2: 0, 3: 13, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!