ID: 1145032427_1145032429

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1145032427 1145032429
Species Human (GRCh38) Human (GRCh38)
Location 17:19515058-19515080 17:19515080-19515102
Sequence CCTGCCATCGTGCGCAGATAATT TTTTGTATTTTTGTAGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 57, 3: 1385, 4: 13947} {0: 1320, 1: 7530, 2: 11990, 3: 22010, 4: 76216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!