ID: 1145032427_1145032432

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1145032427 1145032432
Species Human (GRCh38) Human (GRCh38)
Location 17:19515058-19515080 17:19515100-19515122
Sequence CCTGCCATCGTGCGCAGATAATT AGGGTTTCACCATGTTGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 57, 3: 1385, 4: 13947} {0: 29630, 1: 119747, 2: 180457, 3: 189702, 4: 141729}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!