ID: 1145103405_1145103412

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1145103405 1145103412
Species Human (GRCh38) Human (GRCh38)
Location 17:20095570-20095592 17:20095593-20095615
Sequence CCTGTGGTTCTTCTCGTGGCTGG CTAACGGGCTGTGAGGGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 115} {0: 1, 1: 0, 2: 0, 3: 17, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!