|
Left Crispr |
Right Crispr |
Crispr ID |
1145111036 |
1145111045 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:20161868-20161890
|
17:20161908-20161930
|
Sequence |
CCCTGCAACTTCTGCCTCCCAGG |
CCTCAGCCTCTTGAGTACCTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302} |
{0: 74, 1: 6144, 2: 117485, 3: 220419, 4: 240586} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|