ID: 1145111036_1145111045

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1145111036 1145111045
Species Human (GRCh38) Human (GRCh38)
Location 17:20161868-20161890 17:20161908-20161930
Sequence CCCTGCAACTTCTGCCTCCCAGG CCTCAGCCTCTTGAGTACCTGGG
Strand - +
Off-target summary {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302} {0: 74, 1: 6144, 2: 117485, 3: 220419, 4: 240586}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!