ID: 1145190824_1145190843

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1145190824 1145190843
Species Human (GRCh38) Human (GRCh38)
Location 17:20841562-20841584 17:20841596-20841618
Sequence CCCAAGAGGGGACCAGGCCGGGG GGCTTCCCTGGGAGGAAGGTGGG
Strand - +
Off-target summary {0: 2, 1: 9, 2: 2, 3: 25, 4: 185} {0: 9, 1: 3, 2: 6, 3: 41, 4: 405}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!