ID: 1145210679_1145210688

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1145210679 1145210688
Species Human (GRCh38) Human (GRCh38)
Location 17:21011075-21011097 17:21011120-21011142
Sequence CCCTGCTTTGGTCCTGATGGAGC CGCCCCCGCCGTGTGGGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 189} {0: 1, 1: 1, 2: 2, 3: 12, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!