ID: 1145235077_1145235082

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1145235077 1145235082
Species Human (GRCh38) Human (GRCh38)
Location 17:21202492-21202514 17:21202510-21202532
Sequence CCAGTGGAAACCCCGGTCCTGGA CTGGAACCGACTGCCCCATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 109} {0: 1, 1: 0, 2: 0, 3: 6, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!