ID: 1145327838_1145327839

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1145327838 1145327839
Species Human (GRCh38) Human (GRCh38)
Location 17:21845914-21845936 17:21845943-21845965
Sequence CCACTGGGGCTATTAAGGTAGTT TATTATCTTTAGAAGTTTTATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!