ID: 1145778090_1145778093

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1145778090 1145778093
Species Human (GRCh38) Human (GRCh38)
Location 17:27543418-27543440 17:27543434-27543456
Sequence CCTGCAGGGTAGGGGTGTGAGGC GTGAGGCCTCCATGTTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 231} {0: 1, 1: 0, 2: 0, 3: 14, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!