ID: 1145780145_1145780152

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1145780145 1145780152
Species Human (GRCh38) Human (GRCh38)
Location 17:27557380-27557402 17:27557422-27557444
Sequence CCCCTCTTTCCAGGCAAGAATTA GCTGCTGGTGCCCACTGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 182} {0: 1, 1: 0, 2: 3, 3: 45, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!