ID: 1145825987_1145826007

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1145825987 1145826007
Species Human (GRCh38) Human (GRCh38)
Location 17:27877710-27877732 17:27877757-27877779
Sequence CCTGCCTCCCCTACCGTGGGCCC CTGTGGCAGCACAGGGGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 356} {0: 1, 1: 0, 2: 8, 3: 69, 4: 526}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!