ID: 1145910003_1145910012

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1145910003 1145910012
Species Human (GRCh38) Human (GRCh38)
Location 17:28537010-28537032 17:28537035-28537057
Sequence CCCTGACCCCTGCTCTCTGCAGC GTGAAGATTGACAGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 69, 4: 737} {0: 1, 1: 0, 2: 2, 3: 34, 4: 486}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!