ID: 1145927662_1145927673

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1145927662 1145927673
Species Human (GRCh38) Human (GRCh38)
Location 17:28659703-28659725 17:28659739-28659761
Sequence CCTCACTTCCCAGACGGGGTGGC CCCTCCTCATATCCCAGACGGGG
Strand - +
Off-target summary {0: 1882, 1: 2591, 2: 6222, 3: 11614, 4: 5578} {0: 1, 1: 8, 2: 752, 3: 4349, 4: 4420}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!