ID: 1145933501_1145933506

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1145933501 1145933506
Species Human (GRCh38) Human (GRCh38)
Location 17:28701963-28701985 17:28702004-28702026
Sequence CCGGACTCTGGGCTGTGACTGGG GAGTCTCCCCTAGCTCTCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 171, 4: 522} {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!