ID: 1145935139_1145935146

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1145935139 1145935146
Species Human (GRCh38) Human (GRCh38)
Location 17:28710963-28710985 17:28710979-28711001
Sequence CCGAAAGGAGTAGGGTGGGAAGG GGGAAGGGAGGGAAGGAGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 244} {0: 1, 1: 11, 2: 181, 3: 2065, 4: 12420}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!