ID: 1145960518_1145960526

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1145960518 1145960526
Species Human (GRCh38) Human (GRCh38)
Location 17:28884235-28884257 17:28884263-28884285
Sequence CCCGTCACAGTTAAAGCTACCCC CCGTCTCTACGTCCTCGCAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 60} {0: 1, 1: 0, 2: 0, 3: 0, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!