ID: 1145969664_1145969668

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1145969664 1145969668
Species Human (GRCh38) Human (GRCh38)
Location 17:28949697-28949719 17:28949714-28949736
Sequence CCGAGGGCAGCGGGCGCGCGGGC GCGGGCAGGCAAGCGGCACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 253} {0: 1, 1: 0, 2: 0, 3: 6, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!