ID: 1145972921_1145972935

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1145972921 1145972935
Species Human (GRCh38) Human (GRCh38)
Location 17:28967550-28967572 17:28967593-28967615
Sequence CCAGTCCAGGATGGGATGGAGAA CCAGAGTGGAGGAGGTTAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 186} {0: 1, 1: 0, 2: 1, 3: 26, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!