ID: 1145976736_1145976744

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1145976736 1145976744
Species Human (GRCh38) Human (GRCh38)
Location 17:28988267-28988289 17:28988301-28988323
Sequence CCTCCTGGGGGCACTTCCTAGTG CATGAATGGCTTGTGTCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 97, 4: 1076} {0: 1, 1: 0, 2: 1, 3: 9, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!