ID: 1146004981_1146005001

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1146004981 1146005001
Species Human (GRCh38) Human (GRCh38)
Location 17:29155419-29155441 17:29155462-29155484
Sequence CCTGCCGCCCTGTGTGGACCCTG TGAGAGGTGCTGGGGAGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 270} {0: 1, 1: 0, 2: 15, 3: 133, 4: 1224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!