ID: 1146057640_1146057657

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1146057640 1146057657
Species Human (GRCh38) Human (GRCh38)
Location 17:29589266-29589288 17:29589310-29589332
Sequence CCGGCGCCCGCCCGGCGGCGGCC GGCCCCGCCGCGCTTACCCGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 77, 4: 601} {0: 1, 1: 0, 2: 0, 3: 8, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!