ID: 1146078917_1146078922

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1146078917 1146078922
Species Human (GRCh38) Human (GRCh38)
Location 17:29759582-29759604 17:29759623-29759645
Sequence CCTTCAACCCCTAGCAACTACCA TGAATTTGACTTCTATAGATAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 26, 3: 237, 4: 1057} {0: 1, 1: 0, 2: 2, 3: 21, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!