ID: 1146087973_1146087978

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1146087973 1146087978
Species Human (GRCh38) Human (GRCh38)
Location 17:29847876-29847898 17:29847902-29847924
Sequence CCTCAATTTGCATTAACCTGCCC AATTTACATGTAATTGAAAGTGG
Strand - +
Off-target summary {0: 6, 1: 11, 2: 23, 3: 46, 4: 157} {0: 6, 1: 26, 2: 122, 3: 268, 4: 747}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!