ID: 1146090692_1146090704

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1146090692 1146090704
Species Human (GRCh38) Human (GRCh38)
Location 17:29874404-29874426 17:29874456-29874478
Sequence CCCAGATCTCATCTTGAATTGTA AGGTGGACTTAATTGAATCATGG
Strand - +
Off-target summary {0: 163, 1: 7168, 2: 10574, 3: 9468, 4: 7823} {0: 2, 1: 40, 2: 1227, 3: 2387, 4: 4672}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!