ID: 1146145491_1146145498

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1146145491 1146145498
Species Human (GRCh38) Human (GRCh38)
Location 17:30412601-30412623 17:30412651-30412673
Sequence CCATGAGGCTGCAGCCTCGCAGG GAATAAGGCTTCGTGGGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 9, 3: 76, 4: 325} {0: 1, 1: 0, 2: 18, 3: 190, 4: 682}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!