ID: 1146150624_1146150626

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1146150624 1146150626
Species Human (GRCh38) Human (GRCh38)
Location 17:30466665-30466687 17:30466678-30466700
Sequence CCAACAAGGGGCCTAAGAGTGGC TAAGAGTGGCTGCCCCTGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 80} {0: 1, 1: 0, 2: 0, 3: 15, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!