ID: 1146161301_1146161310

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1146161301 1146161310
Species Human (GRCh38) Human (GRCh38)
Location 17:30560592-30560614 17:30560624-30560646
Sequence CCTCCCATGCCTACTTTCCCCAC TCGGGCTCACCCCGTGCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 34, 4: 330} {0: 2, 1: 0, 2: 16, 3: 10, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!