ID: 1146187184_1146187201

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1146187184 1146187201
Species Human (GRCh38) Human (GRCh38)
Location 17:30731719-30731741 17:30731764-30731786
Sequence CCTCCTTCCCTCCTCTCCTCCTG CTCTCTCCTCCTTCTCCCCTCGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 81, 3: 829, 4: 4900} {0: 1, 1: 2, 2: 10, 3: 105, 4: 860}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!