ID: 1146236066_1146236068

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1146236066 1146236068
Species Human (GRCh38) Human (GRCh38)
Location 17:31164041-31164063 17:31164058-31164080
Sequence CCTCACAGTAACCTTGATGATAC TGATACTTCCCTCATTTTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 98} {0: 1, 1: 0, 2: 0, 3: 24, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!