ID: 1146251241_1146251245

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1146251241 1146251245
Species Human (GRCh38) Human (GRCh38)
Location 17:31345942-31345964 17:31345977-31345999
Sequence CCACCTCATGTACATGGTATTGA TGAACCATTAGTCCAGCAGGAGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 0, 3: 3, 4: 92} {0: 4, 1: 1, 2: 1, 3: 5, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!