ID: 1146365424_1146365430

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1146365424 1146365430
Species Human (GRCh38) Human (GRCh38)
Location 17:32221540-32221562 17:32221586-32221608
Sequence CCATTTTAAATGCTTTCTCTTTT CCTTTAAATGCAGGTGGTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 191, 4: 1700} {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!