ID: 1146404858_1146404867

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1146404858 1146404867
Species Human (GRCh38) Human (GRCh38)
Location 17:32528280-32528302 17:32528324-32528346
Sequence CCTTTGGAGAGCTGGTAGCAAGG CAGGTGGGAGAGGGTGAGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 135} {0: 1, 1: 2, 2: 3, 3: 60, 4: 754}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!